• 목록
• 답변
• 글쓰기
• 게시판 리스트 옵션
  • 수정
  • 삭제

Ould encode a protein of 327 amino acids with an ATG start codon at position 35 and a TGA stop codon at position 1,016 (Fig. 5). The complete cDNA of Aa-eng-2 was 1,107 bp in length and also contained a potential ORF of 327 amino acids with an ATG start codon at position 35 and TGA stop codon at 1,016. A signal peptide of 19 amino acids is predicted by SignalP [63] at the N terminus of the deduced AA-ENG-1 and AA-ENG2 polypeptides. The predicted molecular masses of the putative mature proteins were 34.130 kDa and 34.059 kDa respectively and the theoretical pI value was 6.2 for both proteins. The AA-ENG-1 and AA-ENG-2 proteins contained a catalytic domain homologous to GHF5 -1,4endoglucanases as predicted by PRODOM [64]. The deduced amino acid sequences showed highest similarity with the GHF5 endoglucanase from the migratory plant parasitic nematode Radopholus similis (GenBank Accession No. [ABV54446]). The highest non-nematode similarities of both AA-ENG-1 and AA-ENG-2 were with the -1,4endoglucanase from Cytophaga hutchinsoni (cellulolytic gliding bacterium; GenBank Accession No. [YP_678708]). AA-ENG-1 and AA-ENG-2 share 99 identity in their amino acid sequences. Genomic clones of Aa-eng-1 and Aa-eng-2 were obtained by PCR amplification using gene-specific primers (TableThe full-length sequences of the cellulases were identified from two plasmid clones whose EST sequences are part ofTable 5: Primers used in the analysis of cell-wall-degrading enzymesPrimers Eng1-0F Eng1-0R Eng1-1F Eng1-10F Eng1-10R Eng2-20R Pel1-0F Pe11-0R Pel1-1F Pe11-10F Pe11-10R Pe11-20F Pe12-0F Pe12-0R Pe12-10F Pe12-10RSequence (5' to 3') CTCTACGGGATGAAGTGTCT TTAACAAAAGCGGTACAAG GCTCAAGGTCGTCGTCGAGG GGCATCTCCGAGGCCGACG CTTGCCGTACTCCTGCGCGAT GCTACTTTGCTGGTCCACGT TCCGACGACAACGTCAACCA AAACCCTCAGCATGTTTGATAC TCGAGAACGTCTGGTGGGA CTTGGAGGTACGCTTCGTACG TGACCTTCTTCGCCGCAGTG GAAATGGTACGATTAGTCCTG TCAGTCGGACAGCTTTTCCTC AGCAGGCATTTCGTCGACAC CGAGATGGCACGGGTGCCGA CGTAGCGAGAAATTTTCGATCAUse In situ hybridization, amplification of cDNA and gDNA of Aa-eng-1 and Aa-eng-2 In situ hybridization, amplification of cDNA and gDNA of Aa-eng-1 and Aa-eng-2 Sequencing of cDNA and gDNA of Aa-eng-1 and Aa-eng-2 Sequencing of gDNA of Aa-eng-1 and Aa-eng-2 Sequencing of gDNA of Aa-eng-1 and Aa-eng-2 Sequencing of gDNA of Aa-eng-2 In situ PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/10389946 hybridization, amplification of cDNA and gDNA of Aa-Pel-1 In situ hybridization, amplification of cDNA and gDNA of Aa-Pel-1 Sequencing of cDNA and gDNA of Aa-Pel-1 and Aa-Pel-2 Sequencing of gDNA of Aa-Pel-1 Sequencing of gDNA of Aa-Pel-1 Sequencing of gDNA of Aa-Pel-1 Amplification of cDNA and gDNA of Aa-Pel-2 Amplification of cDNA and gDNA of Aa-Pel-2 Sequencing of gDNA of Aa-Pel-2 Sequencing of gDNA of Aa-Pel-Page 9 of(page number not for citation purposes)BMC Genomics 2009, 10:http://www.biomedcentral.com/1471-2164/10/M K C L L I Lenalidomide A F V G L A A C Q Y A T A L G ATC ATT CAG CCG GGC CTT CAG CGG CTC TAC GGG ATG AAG TGT CTT CTG ATC GCG TTC GTC GGC CTT GCC GCG TGT CAG TAT GCG ACC GCC TTG Eng1-0F T A K D P P Y G Q L S V K G V Q L V G K D G Q P V Q L R G M S L ACC GCC AAG GAC CCG CCG TAC GGC CAG CTC TCC GTG AAG GGC GTC CAG CTC GTG GGC AAG GAC GGC CAA CCG GTC CAG CTG CGC GGC ATG TCG CTC Intron 1 F W S Q W M G Q F W T K D V V K A I A C Q W N G N L I R A A M G TTC TGG AGC CAG TGG ATG GGC CAG TTC TGG ACG AAG GAC GTG GTG AAG GCG ATC GCG TGC CAG TGG AAC GGC AAC CTG ATC CGC GCC GCG ATG GGC205284V D Q G G Y L S N K Q G E L Q K L K V V V E A A I E A G I Y V I GTC GAT CAG GGC.